www.ncbi……

most horrible time, these last 2 hrs

have taken up a totally crazy subject called computational biology….

and believe me, by the end of this course, I will become an EXPERT in googling.

The first assignment is going from site to site to find out gene sequence of man, woman , child, dog , horse, bacteria, etc etc

and after 4-5 hrs of searching, the only great thing to happen was i found a MIT web page which had partial answers to all the assignment problems…

till next time
ATGCCGTAGGTCCCAATTGGCCAATGACGTACGTTTGCAATGCATGGTACCTTGAACCGGTTAAAAACGTGCATGTGAGT

Advertisements
  1. Leave a comment

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s

%d bloggers like this: